Aller au contenu

Utilisateur:Rathova/Brouillon

Une page de Wikipédia, l'encyclopédie libre.

Firmicutes-HTH-transcription-regulator

[modifier | modifier le code]
Consensus secondary structure of the Firmicutes-HTH-transcription-regulator sRNA Family (by LocARNa [1] prediction)

It's a RNA family discoverd by bioinformatics (rfam cloud pipeline[2]) and they are sRNA with an hypothetical effect on HTH transcription regulator. These RNAs are next to transcriptional HTH type genes. They are generally situated in 5’ of the transcriptional regulator and this RNA family is found among the large phylum of Firmicutes.

The first sequence which permit to find this family was first published in this publication[3].


The following sequence is the one that allow to create the seed alignement:

>CD630_SQ2397 (sRNA)

CTTTTTTACGCATAATACACCACCTCCATACATTTTACTGTTCCTGTTATAATAGTGACAGGTATAGAAAAACGTATTGT

ATAGTTGTACAGTTCCTATTATGCGTATCAAAGATAAAACTATGCTGCTGAAACGGAAATAAAAAAAACCGTTATTTGGC

AGTACACTTTTCTTGCGTCAAAATCTCATAAATCTTTCCAGACGACGGTTTGACAAAAGCCGCCGTCTTTCTTTTTTCC

AGAATA


  1. ↑ « LocARNA - Alignement & Folding »
  2. ↑ « Rfam cloud pipeline - Rfam Help documentation »
  3. ↑ « Genome-Wide Identification of regulatory RNAs in the Human Pathogen Clostrodium difficile »
Ce document provient de « https://fr.wikipedia.org/w/index.php?title=Utilisateur:Rathova/Brouillon&oldid=166526545 ».